Java Question 6b Affine Type Monoalphabetic Substitution Cipher Letter Alphabet Mapped Nu Q43869492
In Java … Only question 6B
The affine is a type of monoalphabeticsubstitution cipher, where each letter in an alphabet is mapped toits numeric equivalent, encrypted using a simple mathematicalfunction, and converted back to a letter.
6. In this problem you are to get your hands dirty doing some program- ming. Write some code that creates a new alphabet (A,C, G,T). For example, this alphabet could correspond to the four nucleotides ade nine, cytosine, guanine, and thymine, which are the basic building blocks of DNA and RNA codes. Associate the letters A, C,G,T with the numbers 0, 1, 2, 3, respectively. (a) Using the shift cipher with a shift of 1, encrypt the following sequence of nucleotides which is taken from the beginning of the thirteenth human chromosome: GAATTCGCGGCCGCAATTAACCCTCACTAAAGGGATCT CTAGAACT. (b) Write a program that performs affine ciphers on the nucleotide alphabet. What restrictions are there on the affine cipher? Show transcribed image text 6. In this problem you are to get your hands dirty doing some program- ming. Write some code that creates a new alphabet (A,C, G,T). For example, this alphabet could correspond to the four nucleotides ade nine, cytosine, guanine, and thymine, which are the basic building blocks of DNA and RNA codes. Associate the letters A, C,G,T with the numbers 0, 1, 2, 3, respectively. (a) Using the shift cipher with a shift of 1, encrypt the following sequence of nucleotides which is taken from the beginning of the thirteenth human chromosome: GAATTCGCGGCCGCAATTAACCCTCACTAAAGGGATCT CTAGAACT. (b) Write a program that performs affine ciphers on the nucleotide alphabet. What restrictions are there on the affine cipher?
Expert Answer
Answer to In Java … Only question 6B The affine is a type of monoalphabetic substitution cipher, where each letter in an alphabe…
OR