2) Store the following DNA sequence in a variable: GCTATGCCCCGCTGCTACGTACGAATAGTACAATCTTAAGGGCTATCACTCAGTACGT Write a code snippet that finds the start (ATG) and stop (TAA) codons and prints to the sc…
2) Store the following DNA sequence in a variable: GCTATGCCCCGCTGCTACGTACGAATAGTACAATCTTAAGGGCTATCACTCAGTACGT Write a code snippet that finds the start (ATG) and stop (TAA) codons and prints to the screen the sequences from the start to stop (inclusive). Use the find() function and string slicing.
OR